Presentasjon lastes. Vennligst vent

Presentasjon lastes. Vennligst vent

Dr.med. Hallvard Lærum, Stab IKT, Oslo Universitetssykehus Espen Skorve, Institutt for Informatikk, Universitetet i Oslo HelsIT, 18.septemer 2012 Hvilke.

Liknende presentasjoner


Presentasjon om: "Dr.med. Hallvard Lærum, Stab IKT, Oslo Universitetssykehus Espen Skorve, Institutt for Informatikk, Universitetet i Oslo HelsIT, 18.septemer 2012 Hvilke."— Utskrift av presentasjonen:

1 dr.med. Hallvard Lærum, Stab IKT, Oslo Universitetssykehus Espen Skorve, Institutt for Informatikk, Universitetet i Oslo HelsIT, 18.septemer 2012 Hvilke IT-tekniske (og andre) utfordringer stiller genteknologien helsevesenet overfor?

2 Bakgrunn • Det er nå praktisk og økonomisk mulig å sekvensere alle genene hos en pasient ved hjelp av High Throughput Sequencing (HTS)-teknikker. • Funnene fra slike undersøkelser danner grunnlag for såkalt individualisert medisin, og har konsekvenser for alt fra valg av behandling til hvilken risiko pasienten har for å bli syk. • Få leger har tilstrekkelig kunnskap om disse omfattende funnene, og vi tror det er lite sannsynlig at helsepersonell vil kunne tilegne seg kunnskapen på egen hånd. • Teknikken skaper en rekke tekniske, medisinske, etiske og juridiske utfordringer.

3 • Tverrfaglig forskningsprosjekt støttet av Norges forskningsråd i VERDIKT-prosjektet • Samarbeid mellom OUS og UiO – Avd. for medisinsk genetikk OUS – Stab IKT OUS – Avd. for farmakologi OUS – Norwegian Sequencing Center – Inst. for informatikk UiO – USIT – Juridisk fakultet UiO genAP

4 Mål for genAP-prosjektet • Utforme plattform for å lagre og tilgjengeliggjøre data fra sekvensering av hele pasientens arvemateriale – Automatisering av analyseprosess fra rådata til genetiske funn • Sørge for sikker lagring og tilgangsstyring etter gjeldende lover og forskrifter – Støtte sikker formidling av genomdata nasjonalt – Gi innspill til endring av bioteknologiloven ut fra kliniske behov demonstrert av plattformen • Støtte bruk av genetiske data i klinisk praksis ved å formidle tolkninger av dem – Prøve ut og tilpasse internasjonale innholdsstandarder for genetiske rapporter for integrasjon i elektronisk pasientjournal. – Utvikle algoritmer for tolkning av genetiske funn innen diagnostikk og prognose, behandlingsanbefalinger (farmakogenomikk) og prediktive tester (risiko for sykdom)

5 Genetisk variasjon • Hvert genom har 3.4 milliarder basepar – ATTCATTCCATAGGCAAGTTATTATFGGC…… • Hver person har millioner av varianter i sitt genom – En stor andel genetiske varianter er ikke beskrevet før – I gjennomsnitt har hver person 70 varianter (mutasjoner) som er helt nye, dvs. er verken arvet fra mor eller far – I gjennomsnitt har hver person 100 ”loss of function” varianter, som isolert sett burde gitt sykdom. Det gjør de ikke.

6 Hvilke deler av DNA blir analysert? Intron Ekson Intron Ekson Intron Reguleringsseter, Copy Number Variations (CNV), non-coding regions ”Targeted” Eksom Fullgenom

7 Genetikk er relevant for ”alle” pasienter • Behandling – Dosering av takrolimus (Prograf, Advagraf) ved organtransplantasjon – Dosering av warfarin (Marevan) – Dosering av nevroleptika – Valg og dosering av betablokkere og kalsiumkanalblokkere – Innsetting av Implantabel Cardioverter-Defibrillator (ICD) ved mistanke om arvelig hypertrofisk kardiomyopati • Forenklet diagnostikk – Hypertrofisk kardiomyopati – Mental retardasjon hos barn • Prognose – Hypertrofisk kardiomyopati – Huntington’s chorea • Risiko – Arvelig risiko for brystkreft – Type 2 Diabetes – Schizofreni og bipolar manisk-depressiv lidelse

8 Marevan (Warfarin) • Farlig legemiddel – 21 pasienter døde på grunn av Marevan i Norge i 2011 (blødning) fikk resept på medikamentet i • Genetisk styrt behandling gir riktigere dosering (1) – NEJM 2009: Bedre tilpasset dosering ved bruk av genetiske data enn kliniske algoritmer eller fast dosering. • Aktuelle genvarianter – CYP2C9: Variantprevalensen for *2 og *3 er hhv. 10% og 6% hos hvite (kaukasiere) • *1: normal warfarindosering • *2: 30% reduksjon av metabolisme • *3: 90% reduksjon av metabolisme – VKORC1: ”A”- allel gir lavere produksjon av VKORC1 enn ”G”-allel, og dermed mindre behov for warfarin. 37% av hvite har ”A”-allel • Men: CYP4F2: rs varianten gir lavere CYP4F2 og dermed høyere nivå av vitamin K, dvs. større behov for warfarin. • Tør vi gi marevan til pasienter med kombinasjonen CYP2C9*3 og VCORC1-A ? – Skal ha dramatisk redusert dosering (under 10%) • Tør vi behandle pasienter med marevan uten å vite dette? (1) “Estimation of the Warfarin Dose with Clinical and Pharmacogenetic Data.” New England Journal of Medicine 360, no. 8 (February 19, 2009): 753–764.

9 Takrolimus • Legemiddel for organtransplantasjon – Takrolimus er et immunsupprimerende legemiddel som brukes for å unngå frastøtning ved organtransplantasjon. • Store forskjeller i metabolisme ut fra genetiske varianter – Noen mennesker (ca.15%) har mye høyere metabolisme av takrolimus enn andre, og krever dobbelt så høy dose ved oppstart, dvs. like etter at nyren er transplantert inn. – Flere gener er involvert, men sammenhengen er sterkest for CYP3A5-genet. *1- varianten (homozygot eller heterozygot) gir CYP3A5-uttrykk, og dermed økt metabolisme i forhold til den norske normalbefolkningen. • Forskjellen kan bety liv og død – Pasienter som ikke kommer raskt opp i ønsket legemiddelkonsentrasjon har økt risiko for frastøtning. – De som har frastøtning tidlig etter transplantasjonen får hyppigere frastøtning senere, og har dårligere overlevelse. – CYP3A5 vurderes innført som standard undersøkelse i den nasjonale tx-protokollen.

10 Svært effektiv genetisk utredning Genom- data Hva er CYP3A5, CYP3A4 og POR? CYP3A5 *1/*3 CYP3A4 *18/*1b POR *28/*28 CYP3A5 *1/*3 CYP3A4 *18/*1b POR *28/*28 Genetiker eller legespesialist kan finne ethvert gen bare ved å slå opp i en database

11 Hjelp til styring av behandling Genom- data Hvordan doserer jeg Marevan for akkurat denne pasienten? Et øyeblikk Bzzbzz.. CYP2C9..bzzbzz.. VCORKC1 Bzzbzz.. CYP2C9*1..bzzbz z..VCORKC1*3 Enkelt eksempel Almenpraktiker

12 Hjelp til diagnostikk Genom- data Er dette den arvelige formen for kardio- myopati? Et øyeblikk Bzzbzz.. MYH7..bzzbzz… TNNT2..TPM1… Hei! Den varianten har jeg aldri sett før! Hjelp meg, Kjære genetiker! Hjelp meg, Kjære genetiker! Hm… stoppkodon midt i myomet, det kan umulig gå bra Ok. Noe mer komplisert eksempel Almenpraktiker Genetiker

13 Skal vi bestille en slik genom- sekvensering? Almenpraktiker Informasjonssikkerhet Genom- data Sykehuset vårt kan kartlegge alle slags gener nå. Dette er nyttig for din utredning, og for å velge riktig behandling Sykehuset vårt kan kartlegge alle slags gener nå. Dette er nyttig for din utredning, og for å velge riktig behandling Ok. Det kan tenkes at vi finner risiko for sykdom som du ikke visste om. Det er greit. Vil du vite om det hvis vi finner risiko for en uhelbredelig sykdom? Nei og nei. Denne type hjertesvikt klarer vi ikke å stoppe. Ja… tror det? Så fint! Da bestiller jeg genom- sekvensering Da bestiller jeg genom- sekvensering Flotte greier! Nå fikk vi en forklaring på hjertesvikten din, og medikamentet vi valgte virket jo fint. Pasient Legespesialist Uærlig ansatt Men det var godt vi så det nå. Vi setter inn en slags pacemaker som starter hjertet igjen hvis det begynner å flimre Jeg har dårlige nyheter til deg. Hjertesvikten er av en alvorlig type. Den kommer til å forverre seg over de nærmeste årene. Det var ikke bra. Men det er godt vi vet dette. Vi kan operere inn pacemakeren når tiden er inne, og det vil gi deg beskyttelse i lang tid. Uærlig forsikringsagent Jeg liker ikke dette Men vi får la det stå til Utrolig sånn uflaks jeg har hatt på internett-poker i det siste. Jeg må skaffe mer penger i en fart! Hm… er det noen med ukjent sykdomsrisiko her da? …manisk depressivitet, kanskje?... Huntington’s sykdom…..diabetes....hjertesvikt… DER!..hjertesvikt… DER! Hei Laila! For skal du få en liste over kunder du ikke skal selge livsforsikring til Den er grei. Kjære kunde. Vi beklager at vi ikke lenger kan tilby deg livsforsikring. Eller lån. ???! Uærlig arbeidsgiver Kjære jobbsøker. Vi har vurdert din søknad, og funnet at du nok ikke er aktuell for denne stillingen. ??!!! Kjære kunde! Vi har den aller beste kvikksølv-salve som kurerer akkurat din hjertesvikt Uærlig selger ??!!!

14 Utfordringer

15 Tekniske utfordringer • Middels store datamengder – Ca.1 Gb per genom – Tilsv. 20 CT eller 100 rtg.thorax • Omfattende prosessering – Ca t (104 døgn) per genom for diagnostikk for vanlige servere uten cluster-teknologi – Krav til prosessering begrenser økning av pasientvolum mer enn krav til lagring • ”Enkel” formidling – Få gener brukes i hver tolkning • Identifisering av genvarianter krever tilgang til store databaser i stadig endring – Knytning av hypersensitive data til databaser på internett er en sikkerhetsutfordring – Svakheter i dagens datagrunnlag vil gi behov for å analysere undersøkelser på nytt i fremtiden LagringsbehovEksom 1.5 % av genomet Fullgenom Rådata7 Gb500 Gb Sekvensdata (komprimert FASTA) 14 Mb950 Mb Varianter (ASCII 20 bytes/gen) 500 Kb- ProsesseringEksom 1.5 % av genomet Fullgenom Forskning (BWA) 15 t750 t Diagnostikk (NovoAlign) 50 t2500 t Antall unders. per år Samtidige CPU’er Lagringsbheov per år 500 eksomer717 Gb 500 genomer Gb

16 Medisinske utfordringer • Få leger har oppdatert genetisk kunnskap med relevans for sitt fagfelt ut over diagnostikk – Hovedvekten av genetiske undersøkelser fra amerikanske primærleger dreide seg om vordende foreldre med mistanke om å være bærere av sykdomsgener (Ronquillo et al 2012*) • Individualisert medisin betyr at hver pasient må vurderes for seg, selv om de har samme diagnose – Kritisk å få tilgang på kunnskap som er tilpasset hver enkelt pasient – Tolkning av genetiske funn bør automatiseres og formidles dit leger tar beslutninger om utredning og behandling • Tolkning er i økende grad avhengig av pålitelige og oppdaterte grunndata – Vanlig forekommende varianter med sterke effekter er i hovedsak avdekket – Ny kunnskap vil komme fra effekt av sjeldne varianter, eller kombinert effekt av flere varianter – Kvaliteten på offentlig tilgjengelige databaser med genetisk kunnskap er variabel *

17 Etiske utfordringer • Retten til ikke å vite – Ikke alle vil takle en dårlig prognose – Hva gjør vi med utilsiktede funn? • Retten til ikke å diskrimineres – Risiko for å utvikle sykdom kan påvirke forhold til familie, arbeidsgiver, forsikringsselskap og andre – Genomdata sier også noe om dine foreldres gener; hvem de er og hvor du kommer fra • Retten til personvern, og potensiale for overvåkning – Gensekvensene er så variable at selv kortere utdrag kan være unike for deg – Genomdata kan brukes til å identifisere deg og til å se hvor du har vært • Men også: retten til god helsehjelp – Diagnostikk, forebygging og behandling kan forbedres betydelig med genetiske undersøkelser – Det er uetisk å bli utsatt for bivirkninger eller uvirksom behandling hvis det kan unngås

18 Juridiske utfordringer • Bioteknologiloven kap.5 – Om prediktive undersøkelser • Alle typer skal godkjennes av helsedepartmentet og bioteknologinemda • Pasienten skal gi skriftlig samtykke til undersøkelsen • Pasienten skal gis genetisk veiledning før, under og etter undersøkelsen – Om genetiske masseundersøkelser og farmakogenetiske undersøkelser • Kan godkjennes i forskrift, og kan gi unntak fra kravene over • Konsekvens: Med mindre det gis unntak i forskrift, skal pasienten gi skriftlig samtykke for alle typer genetiske undersøkelser – Kan pasienten gi blankofullmakt til et helt genom? – Er hver ny tolkning av utvalgte gener i et genom en ny undersøkelse? • Helseinformasjonssikkerhetsforskriften og lesing av informasjon på tvers av virksomheter – Egne avtaler mellom virksomheter – Skriftlig pasientsamtykke i hvert tilfelle av tilgang, men kan gis overfor hele virksomheter for en periode – Logging av forespørsel om og resultat av tilgang

19 Ulike brukere trenger ulik tilgang på genetisk informasjon eksempel fra farmakogenetikk Sykepleier Trenger hint om at det genetiske årsaker til en uvanlig høy dosering, men ikke nødvendigvis detaljene fra undersøkelsen Primærlege Trenger praktisk råd om dosering av medikament med overordnet beskrivelse av mekanisme Legespesialist Trenger praktisk råd om dosering av medikament, med beskrivelse av mekanisme og presis angivelse av genvariant Genetiker, bioinformatiker, molekylærbiolog Trenger full tilgang til å søke på aktuelle og beslektede genvarianter med angivelse av klassifisering, analysekvalitet og rene sekvensdata. Praktiske råd og automatisert tolkning tas med som orienterende informasjon.

20 Kan vi skille på gener mtp. hvor stigmatiserende resultatene oppleves å være? • Overlapp! – Om brystkreftpasienter ikke kan omsette tamoxifen til aktiv form (CYP2D6), er prognosen dårligere – Mange diagnostiske tester sier også noe om prognosen (for eksempel kardiomyopati, Huntington’s sykdom). Hva med de som ikke vil vite prognosen om den er dårlig? Gener relevante for:Har betydning for:Stigmatiserende? BehandlingAlt helsepersonell involvert i å yte behandlingen Nei, sjelden DiagnostikkLegespesialisterKan være det, men funnene er som regel ventet Sykdomsrisiko og prognose GenetikereJa, ofte. Eks. psykiatriske tilstander, tilstander med stor funksjonssvikt

21 Utfordringer for kliniske IKT-systemer (1) • Kompliserte krav til informasjonssikkerhet – Tilgangsstyring til deler av pasientopplysningene ut fra rolle, tilsv. skjermet journal for psykiatri – Håndtere pasientsamtykke og tilgang for relevant helsepersonell, samtidig med pasienters rett til ikke å vite • Vil i praksis kreve bedre mekanismer for å formidle samtykke og bekreftelse av tjenestelig behov for tilgang enn vi har i dag • Vanlig svarrapportering er ikke egnet – Et mindre antall genvarianter (eks. CYP-genene) kan ha konsekvenser for et stort antall legemidler eller andre behandlingsformer • Skal man liste opp legemidler på tampen av en svarrapport, eller lage en svarrapport per medikament? – Tolkningene har relevans i lang tid, ikke bare de første månedene etter prøvetakning • Må i så fall alle genetiske svarrapporter memoreres for hver pasient? – Alle kjente fysiologiske mekanismer er i prinsippet berørt • Skal de genetiske svarrapportene ha sin egen subjournal?

22 Utfordringer for kliniske IKT-systemer (2) • Tolkningene av funnene må formidles dit beslutningene tas – Eks. legges inn i beslutningsstøtte – Eks. automatisk oppslag eller ”infobuttons” • Klinisk innhold må struktureres både i rapportene og i mottakende systemer – Angivelse av de genetiske variantene tolkningen er bygget på – Integrasjon med eksisterende pasientopplysninger • Familietrær og arvelige sykdommer • Fysiologiske variabler (blodtrykk, vekt, høyde) – Angivelse av anbefaling etter tolkningen • Legemidler og annen behandling • Laboratorieundersøkelser og andre supplerende undersøkelser • Differensialdiagnoser, angivelse av risiko for tilstander • Påvirkning av tolkninger i andre former for beslutningsstøtte

23 Oppsummering • Kunnskapen om genene er økende, og har betydning for behandling, diagnostikk, prognose og sykdomsrisiko • Sekvensering og formidling av hele pasientgenom gir tekniske og sikkerhetsmessige utfordringer – Jmf. pasientens rett til ikke å vite – Jmf. krav om pasientsamtykke før undersøkelse – Obs uærlige ansatte • Visse gener sier noe om sykdomsrisiko mens andre sier noe om hva slags behandling pasienten skal ha. I lovverket behandles begge deler likt. – Inntil en egen forskrift kommer • Tolkning og forvaltning av informasjonen representerer medisinske utfordringer • ”Enhver” beslutningsstøtte eller protokoll i EPJ må ta høyde for individuelle (les: genetiske) forskjeller.

24 Arkitektur for plattform Her identifiseres sekvensfragmentene fra rådataene, deretter hvilke genvarianter pasienten har. Sekvenser og varianter lagres og gjøres tilgjengelig for øvrige deler av systemet Her bruker genetikere og bioinformatikere egne verktøy for å tolke sekvensdataene om de automatiske tolkningene ikke gir resultat Her produseres rapporter med tolkning av hva pasientens genvarianter betyr for sykdomsrisiko, diagnostikk, behandling, og prognose Her ”bestiller” brukeren rapporter som er relevante for utredning og behandling, og legger evt. inn tilleggsopplysninger som kreves for å tolke de genetiske dataene


Laste ned ppt "Dr.med. Hallvard Lærum, Stab IKT, Oslo Universitetssykehus Espen Skorve, Institutt for Informatikk, Universitetet i Oslo HelsIT, 18.septemer 2012 Hvilke."

Liknende presentasjoner


Annonser fra Google