Presentasjon lastes. Vennligst vent

Presentasjon lastes. Vennligst vent

PCR-reaksjon Forward primer F461-pBET Med sekvens Ttcgccattcaggctacgcaactg [posisjon 461-484 i pBET] for amplifisering av pBET plasmider. Revers primer.

Liknende presentasjoner


Presentasjon om: "PCR-reaksjon Forward primer F461-pBET Med sekvens Ttcgccattcaggctacgcaactg [posisjon 461-484 i pBET] for amplifisering av pBET plasmider. Revers primer."— Utskrift av presentasjonen:

1 PCR-reaksjon Forward primer F461-pBET Med sekvens Ttcgccattcaggctacgcaactg [posisjon i pBET] for amplifisering av pBET plasmider. Revers primer R1137-pBET Med sekvens cagtgagcgaggaagcggaagagc [posisjon i pBET] for amplifisering av pBET plasmider. PCR 700 bp Reaksjons- betingelser Subkloning DNA sekvensering

2 Oversikt

3 Analytisk PCR Variable testet Mg 2+ konsentrasjon mM Noen forskjell? Templat Klonet plasmid Kokte bakterier Like lett å amplifisere? Annealingstemperatur 45 o C 60 o C 72 o C Teoretisk Tm Bruk 2+4 regelen til å estimere Tm Kommenter hvordan disse ligger i forhold til annealingstemp

4 Subkloning av PCR- produkt

5 Finn en feil! Blast vil vise hvilket gen PCR- produktet kommer fra Vil også avsløre en mutasjon - bestem hvilken PCR

6 Mer info Forelesninger legges ut på: %20files/KJB220.html


Laste ned ppt "PCR-reaksjon Forward primer F461-pBET Med sekvens Ttcgccattcaggctacgcaactg [posisjon 461-484 i pBET] for amplifisering av pBET plasmider. Revers primer."

Liknende presentasjoner


Annonser fra Google