Presentasjon lastes. Vennligst vent

Presentasjon lastes. Vennligst vent

1 Genkartlegging Termin IC Frank Skorpen Institutt for laboratoriemedisin, barne- og kvinnesykdommer NTNU.

Liknende presentasjoner


Presentasjon om: "1 Genkartlegging Termin IC Frank Skorpen Institutt for laboratoriemedisin, barne- og kvinnesykdommer NTNU."— Utskrift av presentasjonen:

1 1 Genkartlegging Termin IC Frank Skorpen Institutt for laboratoriemedisin, barne- og kvinnesykdommer NTNU

2 2 Hva er egentlig et genkart? Kartet over det humane genom gir oss posisjonen av de ca 25,000 genene langs de 24 kromosomene, posisjonen i forhold til hverandre, og avstanden mellom dem. To fundamentalt ulike metoder anvendes for å sette sammen genkart over kromosomer: –Fysisk genkartlegging –Genetisk genkartlegging

3 3 Genetisk og fysisk kartlegging Genetisk –På genetiske kart er avstanden et mål på prosent meiotisk overkrysning mellom to eller flere markører. Avstanden angis i centiMorgan (cM). Fysisk –I et perfekt fysisk kart måles avstanden i antall basepar. For andre fysiske kart med lavere oppløsning er det den fysiske avstanden vi observerer ved f.eks. mikroskopi.

4 4

5 5

6 6 Hvorfor genkartlegging? Genkartlegging er et viktig verktøy for å kunne isolere og karakterisere gener som er av interesse i medisinsk sammenheng Genkartlegging er et viktig verktøy for å kunne isolere og karakterisere gener som er av interesse i medisinsk sammenheng

7 7 Hvorfor er gener viktige i medisin? Utfører oppgaven Mutasjon/genvariant Sykdom Informasjon om gen-produktet: Behandling/ profylakse Gentest for å identifisere individer ”at risk” Inneholder oppskriften Kopi av oppskriften

8 8 Fysisk kartlegging - metoder Kromosomfarging In situ hybridisering Celle-hybrid paneler Bacterial Artificial Chromosomes (BAC) DNA sekvensering

9 9 Kromosomfarging - FISH Gjør det mulig å identifisere større delesjoner eller rearrangements

10 10

11 11 Genidentifisering - FISH En metafasecelle positiv for bcr/abl rearrangement (assosiert med kronisk myelogen leukemi), påvist ved hjelp av FISH. Rearrangert

12 12 Cellehybridpanel Humane kromosomer (eller deler av kromosomer) ført inn i celler fra annen art, eksempelvis fra mus eller hamster.

13 13 BAC (Bacterial Artificial Chromosomes) Mapping av gen til et spesifikt kromosomalt segment (Insert size: kb)

14 14 Små, overlappende DNA fragmenter satt inn i vektor egnet for DNA sekvensering

15 15 DNA sekvensering Bestemmer den eksakte rekkefølgen av baser i et DNA molekyl –A - adenine –C - cytosine –G - guanine –T - thymine

16 16 Genkartlegging Genetisk kartlegging –Anvender koblingsanalyse (linkage analysis) for å bestemme avstanden mellom gener.

17 17 Koblingsanalyse –Anvender genetiske ”markører”, og studerer nedarvingen av sykdom og markører i familier –Gjør det mulig å identifisere områder på kromosomer som inneholder et ”risiko-/sykdomsgen”. –Utelukke områder som ikke inneholder et ”risiko-/sykdomsgen”. Markør Risiko-gen

18 18 : 8/10

19 19 OBS!: Ulike typer arv Dominant – recessiv - kjønnsbunden Pleiotropi – Multiple fenotyper Epistasi - Samvirkende gener Polygen arv (kvantitative egenskaper) Ufullstendig penetrans –Genotype 100/100 --> Fenotype 70/100 Maternell/paternell arv (imprinting)

20 20 Genetisk markør Vanligvis ikke den egentlige årsak til sykdommen En genetisk markør er en DNA sekvens med kjent lokalisasjon på et kromosom En genetisk markør må ha den egenskap at den kan skille imellom de to homologe kromosomene (dvs. skille mellom alleler – utgaver – av et gen) som vi arver fra mor og far. Markør Sykdomsgen Mut

21 21 VNTR – gir opphav til flere/mange alleler PCR ”Microsatellite” : repetert enhet < 5 bp ”Minisatellite” : repetert enhet bp GATCGATCGATCGATCGATCGATC

22 22 RFLP – restriksjonsfragment lengde polymorfisme Kløyvingssete for restriksjonsenzym cggccg

23 23 A T C G Singel nukleotid polymorfisme (SNP) Mulige genotyper: AA – AC – CC (TT – TG – GG)

24 24 Koblingsanalyse Søker etter markører som er tilstede hos de med en gitt sykdom (eller annen fenotype), men fraværende hos de som ikke er syke. (Dvs., det anvendes mange markører fra ulike kromosomale områder). Markøren og sykdommen sies da å være “koblet”, dvs. markøren er antatt å ligge i nærheten av “sykdomsgenet”. Utfordring: –Krever DNA fra syke og friske fra samme familie –Krever DNA fra mange familier –Arbeids- og tidkrevende metoder

25 25 Homolog rekombinasjon i meiosen Sannsynligheten for at to loci skal ende opp på separate kromosom ved overkryssing er “proporsjonal” til avstanden mellom dem. Avstanden måles i enheter kallt ”centi- Morgans” (cM). 1 cM tilsvarer 1 recombinasjonshendelse mellom to loci pr 100 meioser (dvs. i 1% av meiosene)

26 26 Genetisk koblingsanalyse v.h.a. RFLP markør

27 27 Humane Chromosome 3 from Science Human Genetic Map, Genome Map V (Life Technologies) VNTR og RFLP markører har vært anvendt til å lage detaljerte genetiske kart over kromosomer

28 28 Hvor stort er et kromosom? Kromosom 1: 263 millioner bp Kromosom 21: 50 millioner bp X: 164 millioner bp Y: 59 millioner bp 1 cM ~ 1 million bp

29 29 Kloning av sykdomsgener Før 1980 var bare et fåtall sykdomsloci kjent (på bakgrunn av biokjemisk karakterisering) Sykdommer som er forbundet med store kromosomale endringer var tidlig identifisert ved hjelp av fargeteknikker og mikroskopi Vi har fire grunnleggende strategier for identifikasjon og kloning av sykdomsgener Posisjonell kloning Posisjonsuavhengig kandidatgenkloning Posisjonell kandidatgenkloning Funksjonell kloning

30 30 Posisjonell kloning Koblingsanalyser i familier (”genom scan” ved bruk av mange markører) brukes for å snevre inn området hvor sykdomsgenet er lokalisert Andre teknikker må brukes for å påvise potensielle sykdomsgen i det aktuelle området –”genome walking”/”- jumping” –DNA sekvensering

31 31 Posisjonsuavhengig kandidatgenkloning Sykdommen kan i mange tilfeller gi indikasjon på hvilke(t) gen som er involvert Dersom man har gode kandidater vil man undersøke disse før man initierer en omfattende genetisk kartlegging Aktuelle teknikker er: –Sekvensering av aktuelle gen –Ekspresjonsstudier (mRNA, protein)

32 32 Posisjonell kandidatgenkloning En kombinasjon av posisjonell kloning og posisjonsuavhengeig kandidatgenkloning Sykdommen kan i mange tilfeller gi en indikasjon på hvilke(t) gen som er involvert Posisjonen av aktuelle gen(er) kan finnes i våre godt utviklete genkart Dersom denne posisjonen sammenfaller med kunnskap om sykdomslokus kan antall kandidatgen reduseres dramatisk

33 33 Funksjonell kloning Kunnskap om den biokjemiske årsaken til sykdommen kan eks. brukes til: –Å rense proteinet (som forårsaker sykdommen), bestemme aminosyresekvensen og syntetisere DNA probe til screening i genbibliotek. –Funksjonell komplementering. Muterte celler (celler med sykdomsgen) komplementeres med humant DNA. Probe

34 34 Assosiasjosstudier Søker etter assosiasjon mellom genetiske markører og sykdom Som oftest Case – Control studier (populasjonsbasert) Kandidatgen-, eller ”Genome-wide association studies” (GWAS) I GWAS kan inntil 1 mill genetiske markører (SNPs), spredt gjennom hele genomet, testes samtidig AffymetrixIllumina

35 35 Genom-wide scan for 7 vanlige sykdommer

36 36 15q25 Lunge- kreft

37 37 Kloning av Cystic Fibrosis (CF) genet ”The CF gene was finally cloned in 1989 at an estimated cost of US$200 million and involved several research labs from several countries”. Chr 7 Flankerende kloner Probe RFLP 1 mill bp Probe RFLP Kloner med deler av CF gen Probe CF-gen: > bp 24 exons mutert i pas. med CF

38 38 Kloning av Cystic Fibrosis (CF) genet Først funnet å være koblet til en RFLP på kromosom 7 Videre mappingstudier viste at genet lå mellom to RFLP- markører, ca 1 Mb (1 mill bp) fra hverandre. Kloner som inneholdt deler av denne regionen ble så isolert ved å benytte DNA som inneholdt RFLP-markørene som probe Disse klonene ble så brukt som prober for å isolere flankerende DNA kloner. Prosedyren gjentatt med de flankerende kloner som probe Flere kloner som til sammen inneholdt CF-genet isolert Analyse av disse, samt isolering av cDNA etterfulgt av sekvensering, viste at CF-genet strekker seg over 250 kb, inneholder 24 exons og gir opphav til et mRNA på ca 6 kb. DNA sekvensering viste at dette var CF genet og at det var mutert i affekterte individer. ”Chromosome walking” ”The CF gene was finally cloned in 1989 at an estimated cost of US$200 million and involved several research labs from several countries”.


Laste ned ppt "1 Genkartlegging Termin IC Frank Skorpen Institutt for laboratoriemedisin, barne- og kvinnesykdommer NTNU."

Liknende presentasjoner


Annonser fra Google