Presentasjon lastes. Vennligst vent

Presentasjon lastes. Vennligst vent

GENER, genregulering, og genfamilier 1-A, H-11 Forelesning 21.11.11 Frank Skorpen, Institutt for Laboratoriemedisin, Barne- og Kvinnesykdommer, DMF, NTNU.

Liknende presentasjoner


Presentasjon om: "GENER, genregulering, og genfamilier 1-A, H-11 Forelesning 21.11.11 Frank Skorpen, Institutt for Laboratoriemedisin, Barne- og Kvinnesykdommer, DMF, NTNU."— Utskrift av presentasjonen:

1 GENER, genregulering, og genfamilier 1-A, H-11 Forelesning Frank Skorpen, Institutt for Laboratoriemedisin, Barne- og Kvinnesykdommer, DMF, NTNU

2 Gener Kromosom, kromatin og DNA Hva er et gen? Hvor mange gener har vi? Struktur og funksjon Genregulering Transkripsjon Signalaktivering Geners regulatoriske områder Transkripsjonsfaktorer Genfamilier Hovedmekanismer for utvikling Eksempler

3 I hver celle i kroppen finnes over 2 m med DNA. DNA finnes i cellekjernen, og noe i mitokondrier. For å få plass er DNA tett pakket i høyere-ordens strukturer Hollow tube: 300 nm i diameter Solenoid: 30 nm i diameter

4 Kromosomer består av DNA og protein Chromatin fiber: 10 nm i diameter DNA dobbel-helix ca 2 nm i diameter Nukleosom

5 I hver celle i kroppen finnes 2,16m med DNA ! Dette skal få plass i cellekjernen, med diameter ~5µm.

6 1 AU = km (~150 mill km) Hvor mye DNA er det i en stud.med.?

7 . 144 x 150 mill km mill km !

8 DNA dobbel-tråden holdes sammen av bindinger mellom basepar (A:T og G:C) Met - Leu - Gly

9 Den ”gamle” definisjonen: Segment av genomisk DNA som koder for en polypeptidkjede eller spesifiserer et funksjonelt RNA molekyl. En nyere (mer upresis) definisjon: Segment av genomisk DNA eller RNA som utfører en bestemt funksjon. Trenger ikke være transkribert eller translatert. Gener er organisert som ”perler på en snor” langs kromosomene.

10 Press Releases: 14th April 2003

11 Humane genom Nukleære genom 3.3 milliarder baser Mitokondrielle genom baser 37 gener Gener og genrelaterte sekvenser DNA utenfor gener ~25% ~75% Kodende DNA (~2.5% av tot.) Ikke-kodende DNA ~ 10% ~ 90%

12 Mennesket har ca gener ~ Human Drosophila melanogaster Caenorhabditis elegans ~ forskj. proteiner

13 Exon Intron 5’ 3’ Exon Intron Promoter Gener består av ”exons” og ”introns” EXON: kodende DNA INTRON: ikke-kodende DNA PROMOTER: område for binding av transkripsjonsfaktorer og RNA polymerase

14 Exon 5’ 3’ Exon 5’ 3’ 5’ cap AAAAAA-3’ Pre-mRNA Fjerning av introns, Spleising av exons 5’ cap AAAAAA-3’ mRNA CYTOPLASMA Promoter Intron

15 Alternativ spleising av exons åpner for produksjon av flere ulike proteiner fra samme gen. 5’ 3’ Exon A B C A B C Protein mRNA 5’-cap AAA-3’

16 mRNA: messenger RNA; koder for aminosyrene i et polypeptid tRNA: transfer RNA; bringer aminosyrene til ribosomer under translasjon rRNA; ribosomal RNA; del av ribosom (som oversetter mRNA til polypeptid) snRNA: small nuclear RNA; danner komplekser med proteiner (eks. i ”spleiseproteiner”) Ikke alle gener koder for protein

17 Alle celler i kroppen inneholder de samme genene. Likevel inneholder ulike celletyper ulike sett av proteiner. Celletype 1 Celletype 2 Gener

18 Alle celler i kroppen inneholder de samme genene. Likevel inneholder ulike celletyper ulike sett av proteiner. Celletype 1 Celletype 2 Gener Proteiner

19 Alle celler i kroppen inneholder de samme genene. Likevel inneholder ulike celletyper ulike sett av proteiner. Ulike celletyper uttrykker ulike sett av gener. Typisk, til enhver tid er bare 3-5% av alle genene i bruk. Celletype 1 Celletype 2 Gener Proteiner

20 Gener er ikke aktive hele tiden, men kan “slås på” av en rekke ulike signaler Hormoner/vekstfaktorer Sol-lys Berøring Smerte Betennelse Næringsstoffer/ vitaminer Virus TRANSKRIPSJON Organiske/uorganiske signalmolekyler Regulering av gen-uttrykk CELLULÆRE FORHOLD M S G1 G2 YTRE FAKTORER

21 Lipofile molekyler Eksempel på overføring av ytre signaler til cellekjernen

22 Gen-uttrykket kan kontrolleres på minst 5 nivåer Dominerende nivå

23 GEN 3’ 5’ Exon Intron (~6-12 bp) Start CORE PROMOTER -200 ProximaleDistale ENHANCER ELEMENTER TATA AKTIVATORER Transkripsjons- maskineri Promoter Geners regulatoriske områder

24 Transkripsjonsfaktorer (aktivatorer) har minst tre funksjonelle domener Dimeriserings- domene Aktiveringsdomene DNA-bindingsdomene P P L L T G C C G G C A Transkripsjonsfaktorer foreligger som oftest i en inaktiv form, og blir aktivert av signaler. eks.: - fosforylering - binding av ligand Når signalet opphører inaktiveres transkripsjons- faktoren. L

25 Transkripsjonsfaktorer (aktivatorer) har minst tre funksjonelle domener DNA-bindingsdomene Dimeriserings- domene Aktiveringsdomene L L T G C C G G C A Transkripsjonsfaktorer foreligger som oftest i en inaktiv form, og blir aktivert av signaler. eks.: - fosforylering - binding av ligand Når signalet opphører inaktiveres transkripsjons- faktoren. L

26 Eksempel på klasser av transkripsjonsfaktorer Merk: de fleste aktive transkripsjonsfaktorer binder som dimerer. De kan være satt sammen av to identiske (homo-) eller to ulike (hetero-) subenheter.

27 Steroid hormon reseptor (inaktiv) TRANSKRIPSJON Eksempel på reseptor-mediert gen-aktivering Steroid hormon Signal- kaskade Insulin reseptor P P PP

28 Gen 1 Gen 2 A BC A BC A A D D E E A F ---ccgcggtatttaaagttacacgtccaattagatatggac tttaaagtcccggggttataatccaattagatatag Ulik oppbygging av regulatoriske områder danner grunnlag for individuell regulering av gener Ingen gener er eksakt lik i måten de regulatoriske områder er bygd opp på (dvs. i DNA sekvens). De vil derfor kunne binde ulike sett av transkripsjonsaktivatorer. Noen elementer kan være ”felles” mellom ulike gener

29 Ulike celletyper uttrykker forskjellige sett av gener, blant annet fordi de inneholder ulike sett av transkripsjonsfaktorer Celletype A Celletype B Transkripsjons- faktorer Uttrykte genprodukter

30 -50+1 TATA Inr RNA pol II IIF IIH IIE IIB IID Aktivatorer rekrutterer RNA pol II og et sett av 5 ”generelle” transkripsjonsfaktorer. Disse er med i transkripsjon av alle gener. Transkripsjons- maskineri AKTIVATORER

31 Regulering av gen-ekspresjon: oppsummering Gen-ekspresjon initieres av signaler Signalene overføres vanligvis via membranbundne reseptorer, eller reseptorer i cytoplasma. Signalet når cellekjernen, og påvirker genuttrykk. Spesielle transkripsjonsfaktorer (aktivatorer) Ansvarlig for spesifikk regulering av transkripsjon. Binder til DNA i genets promoter. Rekrutterer transkripsjonsmaskineriet. Generelle transkripsjonsfaktorer: Ansvarlig for all transkripsjon. Er assosiert med RNA polymerase II, og bidrar til at denne binder korrekt til genets promoter. Utgjør sammen med RNA pol II ”transkripsjonsmaskineriet”. Forskjellige gener aktiveres av ulike sett av transkripsjonsfaktorer (aktivatorer) Ingen gener er eksakt lik i måten promoteren er bygd opp. Hvert gen kan derfor reguleres spesifikt og individuelt. Ulike celler uttrykker ulike sett av gener, bl.a. fordi de inneholder ulike sett av transkripsjonsfaktorer

32

33 Genfamilier E.coliGjærHumant 3.3 x 10 9 bp4.2 x 10 6 bp Både mus, mennesker, bakterier som E.coli og andre former for liv har utviklet seg fra den samme ”stamfar” for noen milliarder år siden. Hvor kommer så det ”ekstra” DNAet som mennesker har fra? Svar: Vårt genom har vokst i størrelse gjennom en gjentagende prosess av duplisering og divergens. 1.2 x 10 7 bp

34 1.Duplisering ved ulik overkryssing 2.Duplisering ved transponering gir spredning av like/beslektede gener gir opphav til gen-”clusters” (ansamlinger av like/beslektede gener) ”Genomisk kompleksitet øker ved genduplisering og seleksjon for nye funksjoner”

35 Meiose 2 n Replikasjon Meiose I Meiose II n Søster- kromatider Overkryssing (rekombinasjon) Slik “homolog rekombinasjon” krever sekvenslikhet (homologi) mellom områder på kromosomene

36 Seter for rekombinasjon A B C A’ B’ C’ Initiell duplisering av singel-kopi region Duplisering ved ulik overkryssing A C’ A’ B’ C B Duplisert gen

37 A’B’C B A’B’C B Sete for overkryssing A’B’C B/B’B Overkryssing Videre ekspansjon fra en duplisert region A’B1C B2B3 Divergens (mutasjoner) Genfamilie med 3 medl.

38  -globin  -globin heme HEMOGLOBIN

39 ”Stamfar”globin gen   AA GG   22 11 22 11 22 11            -globin gen familien (kromosom 16)  -globin gen familien (kromosom 11) Evolusjon Duplikasjon Mutasjon Transponering Duplikasjon/ mutasjon

40  -globin cluster Voksent DNA   AA GG   LCR Føtalt DNA   AA GG   LCR Embryonalt DNA   AA GG   LCR LCR: ”Locus control region” Uttrykket av de ulike globin-genene er regulert gjennom ulike trinn av utviklingene

41 FamilieKopier Komplement C4 gener 2 Vekst hormon gener 5  -globin gener 7 Klasse HLA heavy chain ~20 HOX gener 38 Histon gener ~100 Noen eksempler på ”clustered” multigen familier

42 Unikt- eller lavkopi DNA Repetetivt DNA ~60% ~40% Humane genom Mitokondrielle genom baser 37 gener Nukleære genom 3.3 milliarder baser gener Gener og genrelaterte sekvenser DNA utenfor gener ~25% ~75% Kodende DNA (~2.5%) Ikke-kodende DNA ~ 10% ~ 90% Duplisering ved transponering (”hoppende gener”)

43 Transposable elementer eks. Alu Slike elementer/sekvenser danner grunnlag for baseparing mellom ikke-homologe regioner, og kan resultere i ureglementert overkryssing mellom kromosomer, samt ”transponering” av gener til andre kromosomale posisjoner. Eksempler på slike elementer er Alu, LINE, Mer, Mir. eks. kromosom 4 kromosom 11 Transposable elementer ble først beskrevet av Barbara McClintock sent på 1940 tallet. Ble først ignorert, men fikk senere Nobel prisen (1983). Repetetivt DNA finnes spredt rundt i genomet i stort antall

44 ATCCGGT TAGGCCA ACCGGAT TGGCCTA 5’ 3’ 5’ 3’ Inverted repeat Transposabelt element (TE) TE GEN Transposabelt område

45 6 6’ 11 11’ 3 3’ Singel kopi Meiose (dannelse av kjønnsceller)

46 6 6’ 11 11’ 3 3’

47 6’ 11 11’ 3 3’ 6 Økt mengde DNA

48  -globin

49 Mobile elementer (transposoner) kan forårsake sykdom Transposoner er mutagene. De kan skade genomet på ulike måter: Et transposon som setter seg selv inn i et gen vil mest sannsynlig inaktivere genet. Når et transposon forlater et gen, så vil ”hullet” etter transposonet ikke alltid repareres korrekt. Mange kopier av et transposon, eks. Alu-sekvens, kan forstyrre korrekt paring av homologe kromosomer i mitose og meiose. Resultatet kan være ”ulik overkryssing”, en av hovedårsakene for gen-duplikasjon.

50 Genfamilier - oppsummering Det humane genom har ekspandert gjennom en gjentagende prosess av genduplisering og divergens Genomisk kompleksitet øker ved genduplisering og seleksjon for nye funksjoner To hovedmekanismer for genduplisering: ulik overkryssing mellom homologe kromosom transponering mellom kromosomer De fleste genduplikasjoner gir opphav til ”pseudogener”, dvs. inaktive gener.


Laste ned ppt "GENER, genregulering, og genfamilier 1-A, H-11 Forelesning 21.11.11 Frank Skorpen, Institutt for Laboratoriemedisin, Barne- og Kvinnesykdommer, DMF, NTNU."

Liknende presentasjoner


Annonser fra Google