Presentasjon lastes. Vennligst vent

Presentasjon lastes. Vennligst vent

1 DNA isolering Elektroforese av DNA og protein Et teoretisk labkurs Medisin IA v/ Anders Sundan.

Liknende presentasjoner


Presentasjon om: "1 DNA isolering Elektroforese av DNA og protein Et teoretisk labkurs Medisin IA v/ Anders Sundan."— Utskrift av presentasjonen:

1 1 DNA isolering Elektroforese av DNA og protein Et teoretisk labkurs Medisin IA v/ Anders Sundan

2 2 Molekylær biologi er i hovedsak studiet av informasjonsbæreren DNA og av funksjonsdetaljene i proteiner De mest brukte metodene Metoder for å studere DNA DNA elektroforese (identifikasjon, rensing) PCR (polymerase chain reaction)(kopiering) Metoder for å studere protein i løsning Protein elektroforese (identifikasjon, rensing) ELISA (Enzymelinked immunosorbent assay)(kvantitering) Metoder for å studere protein på celler Flow cytometri (Mikroskopi, vil ikke bli diskutert)

3 3 Vår kropp inneholder K forskjellige gener -omlag 500K forskjellige proteiner -i tillegg: virus og bakterier Disse er satt sammen forskjellig og har ulik størrelse. Elektroforese er metode for å skille disse fra hverandre...

4 4 Men.... DNA er i pakket godt inn i kjernen, proteiner er overalt inkludert i membraner Det er ca 1 meter DNA i hver celle ( basepar) DNA fra celler må klippes opp eller modifiseres for videre studier: -Oppklipping: Restriksjonsensymer klipper i bestemte sekvenser i DNA (feks i sekvensen G|AATTC eller en av flere hundre andre) -PCR=polymerase chain reaction kopierer selvvalgte områder

5 5 Restriksjonsenzymer - kutter dobbelttråd-DNA sekvensspesifikt

6 6 Ligering

7 7

8 8

9 9 Elektroforese Formålet med elektroforese er å skille makromolekyler med ulik størrelse fra hverandre for identifikasjon og rensing I et elektrisk spenningsfelt vil molekyler med positiv ladning gå mot negative pol og molekyler med negativ ladning gå mot positiv pol I gel-elektroforese skjer dette i en gel

10 10 Elektroforese av oppklipt DNA Etidium bromid i UV lys Radioaktivitet på film

11 11 Etidium bromide interkalerer i DNA og lyser under UV lys

12 12 DNA gel-elektroforese

13 13 Små molekyler finner veien fortere enn store molekyler En gel har porer med varierende størrelse Sett fra siden

14 14 Isolering av DNA O S O O O - CH 2 CH 3 SDS + = Lysering av celler 50 mM Tris-HCI, pH 8.0 1% SDS Tris buffer holder pH stabil for å bevare DNA 1% SDS åpner membraner og gjør DNA løselig i vann samt binder og feller ut protein

15 15 Protease tilsettes for å ødelegge kjerneproteiner og enzymer som bryter ned DNA og øker mengden ekstrahert DNA DNA er ikke løselig i etanol. Tilsats av iskald etanol gjør at DNA felles ut og kan fiskes ut O CH 2 O P O O O Base CH 2 O P O O O Base OH Sugar O

16 16 p53 er delaktig i 30-80% av krefttilfellene... Eksempel fra forskning

17 17 Spørsmål: Hva gjør domene X i p53? Løsning: Lage p53 med og uten X (for videre testing) X X

18 18 p53 i DNA plasmider Disse kan skilles ved elektroforese WT p53 p53  x (uten X) Klipping med restriksjonsenzymer gir DNA fragmenter med ulik lengde X

19 19 Vårt eksempel: Noen DNA er kortere (p53  X) enn andre (p53 WT) Lite p53 DNA fragment Stort p53 DNA fragment

20 20 ACGTTAACGATTCTGTAGTCTAAGGCTCGAATGC 3’ 3’ - TGCTAAGACATCAGATTCCG - 5’ ACGTTAACGATTCTGTAGTCTAAGGCTCGAATGC TGCAATTGCTAAGACATCAGATTCCGAGCTTACG 5’ 3’ DNA hybridisering – påvisning av en bestemt DNA sekvens Nesten alle teknikker vi bruker til å manipulere DNA (og RNA) bygger på sekvens-spesifikk binding av en komplementær DNA tråd. Dette gjelder f.eks. DNA sekvensering, PCR (polymerase kjedereaksjon) etc. Hydrogenbindingene mellom to DNA-tråder kan brytes ved å heve temperaturen. Smeltetemperaturen (dvs. der hydrogenbindingene mellom to komplimentære tråder brytes) bestemmes hovedsakelig av G/C versus A/T innholdet Smeltetemperaturen for en kort (~20 nukleotider) DNA-tråd kan beregnes med formelen:: T m ( C) = 4 x (# C/G) + 2 x (#A/T)

21 21

22 22 PCR-Polymerase kjedereaksjon

23 23 Polymerase chain reaction (PCR) Metode for å amplifisere (kopiere) DNA Kan brukes i komplekse blandinger Oppfunnet av en nordmann (Kjell Kleppe, 1971), patentert av en amerikaner (Mullis, 1983) Kan amplifisere fra 1 stk DNA til detekterbare mengder på timer sykler av Denaturering (95°C 30sek) ”Annealing” (50-60°C 30sek) Polymerisering (72°C 1min) Trikset er å bruke varmestabil DNA polymerase (isolert fra bakterier som lever i varmekilder.)

24 24 Gel-elektroforese brukes til DNA fingerprinting

25 25

26 26 Lengde- standard Positiv kontroll Negativ kontroll Pasient- nummer DNA-elektroforese brukes til HIV- testing av hvilende virus

27 27 Animasjoner av PCR på nettet amples/molecularbiology/pcr.html

28 28 Bruk av Dideoxynukleotider i sekvensering

29 29 DNA sekvensering Dideoxy (Sanger) sequencing

30 30 Elektroforese brukes også til sekvensering av DNA

31 31 Protein elektroforese

32 32 Proteiner er bygd opp av aminosyrer. Det minste proteinet har 44 aminosyrer, det største har aminosyrer Våre 20 aminosyrer

33 33 Figure 2-25 Molecular Biology of the Cell (© Garland Science 2008)

34 34

35 35 Figure 8–16 separasjon av proteiner ved isoelektrisk fokusering At low pH (high H+ concentration) the carboxylic acid groups of proteins tend to be uncharged (–COOH) and their nitrogen-containing basic groups fully charged (for example, –NH3+), giving most proteins a net positive charge. At high pH the carboxylic acid groups are negatively charged (–COO–) and the basic groups tend to be uncharged (for example, –NH2), giving most proteins a net negative charge. At its isoelectric pH a protein has no net charge since the positive and negative charges balance. Thus, when a tube containing a fixed pH gradient is subjected to a strong electric field in the appropriate direction, each protein species present migrates until it forms a sharp band at its isoelectric pH, as shown.

36 36

37 37 Elektroforese av proteiner i serum Normalt serum Serum fra pasient med gamma-globulin (f.eks myelomatose)

38 38 Denaturering av protein med SDS gir proteiner ladning avhengig av størrelse o C

39 39 Protein elektroforese SDS-PAGE (sodium dodecylsulfat-polyacrylamid elektroforesis)

40 40 Et SDS-PAGE apparat

41 41 Gel-elektroforese skiller proteiner fra hverandre på størrelse

42 42 P53 fra DNA til protein WT p53 p53 (uten X) Proteinprodukt Disse kan skilles fra hverandre ved protein- elektroforese (SDS-PAGE)

43 43 SDS-PAGE av vårt protein, p53 Coomassie-farging Str p53  x p53 villtype

44 44 Cellelysat farget med Coomassie Brilliant Blue Celler inneholder mange proteiner, noen av disse er like store

45 45 Intermezzo: Alle kjevede hvirveldyr produserer antistoff for å beskytte seg mot infeksjoner. Antistoffer binder proteiner med svært høy spesifisitet og brukes mye i studien av proteiner. Det kan lages antistoffer mot nærsagt hvilket som helst protein

46 46 Prinsipp for Western blotting

47 47 Vårt protein…. Kjør gel (separasjon) Overfør til en membran Sett på antistoff som gjenkjenner det man leter etter Sett til et enzym (horse radish peroxidase) som omdanner et substrat til lys Fang opp lyset med film Western P53 WT P53  X Mw

48 48 Western blotting for testing av HIV antistoffer i serum

49 49 2-dimensjonale geler 1. Dim: Isoelektrisk fokusering (pI) (et proteins iboende ladning) 2. Dim: SDS-PAGE (et proteins størrelse)

50 50 2D-gel elektroforese

51 51 Elektroforese oppsummering DNA/RNA i agarose-geler –DNA fragment størrelse (farges med ethidium bromide) –Southern Blot (DNA detektert ved hybridisering) –Northern Blot (RNA detektert ved hybridisering) Protein elektroforese –Denaturerte versus ikke-denaturerte proteiner –Polyacrylamid-geler (Sølvfarging, Coomassie) –Western Blot (Påvise spesifikke proteiner) –Isoelektrisk fokusering (nettoladning protein)

52 52 ELISA: Enzyme-linked immunosorbent assay Kvantitativ metode for måling av spesifikke proteiner i løsning (serum, etc) Enkelt prinsipp, kan brukes på svært mange prøver samtidig Høy spesifisitet Kommersielle kit eller kommersielle antistoffer tilgjengelig for mange proteiner Kan lages selv for ”nye” proteiner Baserer seg på enzyme-mediert omdannelse av et substrat til en farge

53 53 ELISA:prinsipp

54 54 Flow cytometri Brukes til å analysere proteiner på enkeltceller i løsning Kan analysere noen celletyper eller noen proteiner samtidig Kan sortere celler etter hvilke proteiner de har

55 55 Eksempel på flow resultat

56 56 Biorad Multiplex (Bioplex) ELISA gjøres på en kule som sendes gjennom et flowapparat


Laste ned ppt "1 DNA isolering Elektroforese av DNA og protein Et teoretisk labkurs Medisin IA v/ Anders Sundan."

Liknende presentasjoner


Annonser fra Google