Presentasjon lastes. Vennligst vent

Presentasjon lastes. Vennligst vent

Fra DNA til Protein Medisin stadium IA, 10. september 2012 Anders Sundan.

Liknende presentasjoner


Presentasjon om: "Fra DNA til Protein Medisin stadium IA, 10. september 2012 Anders Sundan."— Utskrift av presentasjonen:

1 Fra DNA til Protein Medisin stadium IA, 10. september 2012 Anders Sundan

2 Celler inneholder DNA — arvematerialet i de fleste levende system Genomet er organismens komplette sett av DNA som er organisert i kromosomer DNAet inneholder gener som bestemmer hvordan og når proteiner skal bygges Proteiner utøver de mest essensielle funksjoner for liv, og de jobber ofte sammen som molekylære maskiner Molekylære maskiner virker sammen i kompliserte nettverk for å gjøre cellen levende Et samfunn av celler består av alt fra en samling av mikrober i en koloni (hver enkelt mikrobe er kun en celle) til hundre milliarder celler i et menneske.

3 19xx : “Et gen – en fenotype” 1940 : Beadle og Tatum “Et gen – et enzym”. Nobelpris i : “Et gen er alt DNA som er nødvendig for å lage et genprodukt; enten et polypeptid eller strukturelt/katalytisk RNA” 2012: ??? Hva er et gen? All DNA som trengs for å lage et protein

4 HUGO – the HUman GenOme project Sekvensering av det humane genom Startet i 1990 av US Department of Energy og National Institute of Health (NIH), ”ferdig” The International Human Genome Sequencing Consortium – 20 akademiske laboratorier Genomet ble samtidig sekvensert av det private firmaet Celera Genomics 2001 (90%) HUGO Celeraapril 2003 (99%) 50 år siden Watson & Cricks publisering av DNA dobbeltheliks 99% av det humane genom sekvensert med 99.99% nøyaktighet

5 HUGO – the HUman GenOme project Det humane genom består av 3 milliarder nukleotider (A, C, T, and G). Det totale antallet gener er estimert til ca. 25, % av nukleotidsekvensen er identisk i alle mennesker Funksjonen er ukjent for mer enn 50% av genene som er oppdaget Mindre enn 2% av genomet koder for protein Repeterte sekvenser som ikke koder for protein ("junk DNA") utgjør minst 50% av det humane genomet

6 DNA - deoxy-ribonukleotinsyre, inneholder basene Adenin, Guanin, Cytosin og Thymin RNA - ribonukleotinsyre, inneholder basene Adenin, Guanin, Cytosin og Uracil DNA og RNA er polymerer av nukleotider som er knyttet sammen med fosfodiester bindinger fra det tredje karbonatomet i ett ribose-molekyl til det femte karbonatomet i neste ribose-molekyl. Ved at nukleinsyretråden på denne måten får en retning, vil sekvensen av nukleotider kunne inneholde informasjon.

7 Byggesteiner i DNA og RNA

8 De ulike nukleotidene i to DNA tråder kan danne hydrogenbindinger med hverandre på følgende måte: Cytosin og Guanin binder hverandre med 3 hydrogenbindinger: C --- G Thymin og Adenin binder hverandre med 2 hydrogenbindinger: T --- A

9 Base-parring i dobbelttråd DNA To komplementære (dvs der det er C i den ene tråden er det G i den andre, og der det er T i den ene er det A i den andre) og antiparalelle (med motsatt retning) DNA tråder kan danne en svært stabil dobbelt DNA- tråd, der trådene snor seg om hverandre som to korketrekkere (DNA helix). DNA i våre celler finnes vanligvis denne formen.

10 DNA hybridisering – påvisning av en bestemt DNA sekvens Nesten alle teknikker vi bruker til å manipulere DNA (og RNA) bygger på sekvens-spesifikk binding av en komplementær DNA tråd. Dette gjelder f.eks. DNA sekvensering, PCR (polymerase kjedereaksjon) etc. Hydrogenbindingene mellom to DNA-tråder kan brytes ved å heve temperaturen. Smeltetemperaturen (dvs. der hydrogenbindingene mellom to komplimentære tråder brytes) bestemmes hovedsakelig av G/C versus A/T innholdet Smeltetemperaturen for en kort (~20 nukleotider) DNA-tråd kan beregnes med formelen:: T m ( C) = 4 x (# C/G) + 2 x (#A/T) o ACGTTAACGATTCTGTAGTCTAAGGCTCGAATGC - 3’ 3’ - TGCTAAGACATCAGATTCCG - 5’ ACGTTAACGATTCTGTAGTCTAAGGCTCGAATGC TGCAATTGCTAAGACATCAGATTCCGAGCTTACG 5’ 3’ E.g. T m ~ 4 x x 11 = 58 C Ved en temperatur like under smeltetemperaturen vil denne korte DNA-tråden ikke binde noen andre DNA-sekvenser. o

11 Base-parring i RNA

12 Det sentrale dogmet i biologien DNA RNA Protein Deoxyribonukleinsyre - deoxy-ribose + basene A, T, C, G - dobbelttråd Ribonukleinsyre - ribose + basene A, U, C, G - enkelttråd - mRNA, tRNA, rRNA, snRNA, siRNA Polypeptid -20 aminosyrer, peptidbindinger -enkelttråd -et protein er en funksjonell enhet oppbygd av ett eller flere polypeptid Transkripsjon (omskriving) Translasjon (oversettelse)

13 Transkripsjon: DNA RNA Det lages en RNA-kopi av en del av en DNA-tråd som koder for et polypeptid eller et RNA. Den motsatte tråden fungerer som mal = templat

14 Transkripsjon: DNA RNA Transkripsjon i 4 trinn: 1.Initiering 2.Forlengelse (elongering) 3.Terminering 4.Prosessering DNA rRNA: Ribosomalt DNA 4 ulike størrelser (5s, 5.8s, 18s, 28s) Danner ribosomer sammen med proteiner mRNA: Budbringer RNA (messenger RNA) Koder for protein tRNA: Transfer RNA Leser av genetisk kode og overfører aminosyrer RNA pol II RNA pol I RNA pol III

15 Transkripsjon: Initiering Et gen består av en regulatorisk del og en kodende del Promoter = regulatorisk del av et gen direkte oppstrøms (5’) for transkripsjonsstart Transkripsjonsfaktorer er DNA- bindende proteiner som regulerer transkripsjon Transkripsjon

16 I eukaryote celler vil primær-transkriptet prosesseres før mRNA er ferdig. 5’ cap av 7-metylguanosine i trifosfatbinding. 3’ poly-A hale: adenosin festes på. Beskytter mot degradering, bidrar i transport av mRNA ut av kjernen og til initiering av proteinsyntese (translasjon) Transkripsjon: RNA Prosessering

17 Eucaryote gener: kodende DNA sekvenser exon (av expressed = uttrykt) er avbrutt av ikke-kodende sekvenser intron (intervening sequences) I primærtranskriptet kappes intron ut og exon limes sammen igjen til et mRNA som inneholder en kontinuerlig sekvens som koder for proteinet. Denne prosessen kalles RNA spleising.

18 Transkripsjon: RNA Prosessering

19 Transkripsjon: DNA RNA Forskjeller i eukaryot og prokaryot proteinsyntese (transkripsjon og translasjon) er utgangspunktet for behandling med antibiotika

20 Etter at mRNA er ferdig dannet i en eucaryot cellekjerne, blir mRNA transportert ut av kjernen til cytoplasma der proteinsyntesen foregår på ribosomer. En kopi mRNA gir opphav til mange kopier av et protein

21 Proteiner består av aminosyrer I et protein er aminosyrene kjedet sammen med kovalente bindinger som kalles peptidbindinger

22 Dyreceller bruker 20 ulike aminosyrer som byggesteiner i proteiner Sidegruppen (R) er forskjellig og er det som gir hver aminosyre dens spesielle egenskap

23

24 Aminosyrene i et protein bestemmer struktur og funksjon til proteinet

25 Den genetiske koden DNA = deoxyribonukleinsyre - deoxy-ribose + basene A, T, C, G RNA = ribonukleinsyre - ribose + basene A, U, C, G 3 nukleosider i DNA (og RNA) bestemmer (koder for) en aminosyre Dette kalles et kodon

26 Den genetiske koden Etter startkodon (AUG) leses triplettene fortløpende helt til stoppkodon, dvs i det som kalles en åpen leseramme. Leserammen kan endres av mutasjoner i DNA. NormalAUGGCAUUACAGGUAUUACUACGAGGCACACCUGAA...functional geneMetAlaLeuGlnValLeu ArgGlyThrProGluprotein insertionAUGGCAUUUACAGGUAUUACUACGAGGCACACCUGA...premature MetAlaPheArgGlyIleThr ArgHisThrStoptermination ↓ deletionAUGGCAUACAGGUAUUAC GAGGCACACCUGAAA...different MetAlaTyrArgTyr GluAlaHisLeuLysprotein altered baseAUGGCAUUACAGGAAGAAUUACUACGAGGCACACCUGAA...single amino MetAlaLeuGlnGluLeu ArgGlyThrProGluacid change altered baseAUGGCAUUACAGGUAUUACUGCGAGGCACACCUGAA...no change MetAlaLeuGlnValLeu ArgGlyThrProGlu Note that the location of the mutation will dictate the extent of change observed in the primary sequence. Insertion and deletion mutations cause frame shifts that lead to synthesis of nonsense proteins with either premature or delayed termination.

27 Figure 8-52 Molecular Biology of the Cell (© Garland Science 2008)

28 Translasjon: mRNA Protein Proteinsyntesen skjer på ribosomer: 2 subenheter, 40s og 60s 4 rRNA (5s, 5.8s, 18s, 28s) og proteiner Cytosol eller på ER Translasjon er prosessen hvor nukleotidsekvensen i mRNA oversettes til aminosyresekvensen i et protein tRNA bærer aminosyrene og leser av den genetiske koden Aminosyrene kobles sammen til polypeptider som transporteres til ulike deler i cella (eller ut)

29 Translasjonsmaskineriet: tRNA Ett tRNA for hvert kodon (bortsett fra for stopp-kodonene)

30 Translasjonsmaskineriet: tRNA

31 Translasjonsmaskineriet: Ribosom

32 Translasjon: Initiering Samling av kompleks 40S subenheten av ribosomet og tRNA-Met binder 5’ cap mRNA. Scanning Initierings-komplekset beveger seg langs mRNA til første AUG (start) kodon. Her bindes 60S subenheten av ribosomet.

33 Translasjon: Forlengelse (elongering) Peptidyl transferase

34 Translasjon: Terminering 1 2 3

35 Protein targeting Proteiner som skal bli membranproteiner eller som skal eksporteres ut av cella har en N-terminal signalsekvens som dirigerer ribosomet til å utføre resten av translasjonen på endoplasmatisk retikulum (ER)

36 Protein targeting: Sekretorisk protein SRP (Signal Recognition Particle) binder seg til signalsekvensen på proteiner, og translasjonen stopper opp. SRP har en reseptor på ER-membranen, og etter binding av komplekset til ER, frigjøres SRP og syntesen av proteinet fortsetter gjennom en pore i ER-membranen.

37 Protein targeting: Membranprotein

38 Protein targeting

39 Post-translasjonell modifisering Glykosylering (sukkerkjeder) og interne bindinger i ER og Golgi Trimming, spalting, aktivering av pro- peptider (proteolytisk prosessering) Pga post-translasjonell modifisering og alternativ spleising, antar en at proteomet (alle mulige proteiner) er minimum 10 X større enn genomet.

40

41 Størrelse på genomet i ulike arter

42 I eucaryoter fordeler DNA tråden seg på lineære kromosomer, mens procaryoter har ett sirkulært kromosom.

43 DNA dobbelttråden er i celler kveilet rundt spesielle proteiner kalt histoner. En slik kveil (DNA to ganger rundt Histon2-4) kalles et nukleosom

44 Pakking av DNA i nukleosomer gir en kromatin fiber som er ca. 10 nm i diameter. Kromatinet er videre pakket i en fiber som er ca. 30 nm i diameter, og som inneholder ca. 6 nukleosomer pr. Omdreining.

45 Humane metafase kromosomer

46 Figure 4-11 Molecular Biology of the Cell (© Garland Science 2008)

47 Figure 4-12 Molecular Biology of the Cell (© Garland Science 2008)

48 Alle celler med kjerne har samme DNA – hvordan oppstår forskjeller? Regulering Hvor mye og når?

49 Regulering av genekspresjon: Transkripsjonsfaktorer Regulering av transkripsjon er effektivt: Hvor mye av og når et protein skal lages bestemmes ofte på transkripsjonsnivå, dvs at det ofte er en sammenheng mellom mengde mRNA for et protein og mengden av selve proteinet en celle. Regulatoriske DNA-sekvenser: promoter ligger direkte 5’ for transkripsjonsstart enhancersekvenser er ofte mye lengre unna intron kan inneholde regulatoriske sekvenser Transkripsjonsfaktorer er DNA-bindende proteiner som regulerer transkripsjon ved å regulere aktiviteten til RNA polymerase. Aktivatorer og repressorer.

50 Regulering av genekspresjon: Transkripsjonsfaktorer AktiveringInhibering Forekomsten av transkripsjonsfaktorer i ei celle bestemmer genuttrykket – dvs. hvilke proteiner som lages til enhver tid.

51 Regulering av genekspresjon: Signaler utenfra

52 Genotype versus fenotype Genotype - hvilket genom (sum av gener)en organisme eller celle har Fenotype – hvordan organismen (eller en celle) er, oppfører seg og ser ut

53 Figure 4-15 Molecular Biology of the Cell (© Garland Science 2008)

54 Hva er et gen? Problemer: Ett bit (en viss lengde) av DNA kan kode for ulike varianter av ett protein En bit av DNA kan inneholde flere gener (kode for flere proteiner) Regulering av gen-ekspresjon kan skje gjennom direkte transkripsjon av helt andre DNA biter – regulatorisk RNA Det er relativt enkelt å fastslå hvilke deler av DNA som koder for protein, men det kan være svært vanskelig å fastslå hvilke sekvenser som er regulatoriske for et bestemt protein

55 Ett gen kan gi opphav til varianter av et protein ved alternativ spleising av exoner. Ett eksempel på bruk av alternativ spleising er overgangen fra membranbundet til løselig antistoff ved differensiering av B-celler i blod. TM mC msmm TM An DNA mRNA-1 Modne plasmaceller Udifferensierte celler Transkripsjon: RNA Prosessering mRNA-2

56 siRNA – small inhibitory RNA

57 Figure 4-17 Molecular Biology of the Cell (© Garland Science 2008)

58 Det sentrale dogmet i biologien – status i dag: Post-translasjonell modifisering av proteiner

59 Litteratur Lærebøker Lehninger, Principles of Biochemistry 4th e., Eds: Nelson / Cox, Freeman Baynes & Domimiczak, Medical Biochemistry 2nd e., Elsevier Mosby Pollard & Earnshaw, Cell Biology, Saunders Web Nobelkomiteens interaktive sider om DNA til protein: The human genome project: Encode – Encyclopedia of DNA elements September etg. Gastro


Laste ned ppt "Fra DNA til Protein Medisin stadium IA, 10. september 2012 Anders Sundan."

Liknende presentasjoner


Annonser fra Google